Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuG9-1D

[Submit comment/correction]

Locus	XksuG9-1D
Type	RFLP
Chromosome	1D
Chromosome Arm	1DS
Map	1DS, Ae. tauschii 45.5
	[ Show Nearby Loci ]
Map Data	1DS, Ae. tauschii
Species	Aegilops tauschii
Probe	pTtksuG9
Reference	Spielmeyer W et al. (2000) NBS-LRR sequence family is associated with leaf and stripe rust resistance on the end of homoeologous chromosome group 1S of wheat Theoretical and Applied Genetics 101:1139-1144.
Probe for Locus	pTtksuG9
Locus	[ Hide all but 1 of 17 ] KSUG9 DGG9 XksuG9-1A Xksu.DGG9 HD057D1 HI088J17 HD067P8 HI068C2 HD055E16 D1.1_ctg5162 D1.1_ctg5357 G009 XksuG9 XksuG9-1D XksuG9B ksuG9-1A ksuG9
Type	Genomic STS
PCR primers	R:GAGCCTGATGAAGACATTAC L:CGAGTTAAGTCCTTGTATCG
Polymorphism	KSUG9 EcoRI
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.4