Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xcfd48-1B

[Submit comment/correction]

Locus	Xcfd48-1B
Type	Microsatellite
Chromosome	1B
Chromosome Arm	1BL
Map	Chinese_Spring_Deletion_SSR_1B 0.845 [ Show all 6 ]
	[ Show Nearby Loci ]
Breakpoint Interval	1BL2-0.69-1.00*
Map Data	Wheat, Arina x Forno [ Show all 6 ]
Species	Triticum aestivum
Probe	CFD48
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157. Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs	[ Hide all but 1 of 8 ] Xcfd48 Xcfd48-1D Xcfd48.1-1D Xcfd048.2-1B Xcfd48.2-1B cfd48 cfd48-1B cfd48-1D
Probe for Locus	CFD48
Locus	Xcfd48-1B [ Show all 9 ]
Reference	Guyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks	Quality Score = B Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (GT)22 Regularity of motif is imperfect
Type	PCR SSR
PCR primers	Forward 5' ATGGTTGATGGTGGGTGTTT 3' Reverse 5' ATGTATCGATGAAGGGCCAA 3'
SSR size	250
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	1B
Source Species	Aegilops tauschii