Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WMS6

[Submit comment/correction]

Locus	WMS6
Type	Microsatellite
Synonym	Synonym WMS6
Chromosome	4H
Map	Barley-ConsensusFHB-4H 124.52 [ Show all 9 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHei.pil-4H.6
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	WMS6
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin [ Show all 6 ]
Possible Orthologs	Xgwm6 [ Show all 17 ]
Probe	WMS6
Locus	[ Hide all but 1 of 18 ] Xgwm6.1-4B Xgwm6.2-5A Xgwm6-5A WMS6 Xgwm6-4B Xgwm6 Xgwm6-4D.1 Xgwm6-4D.2 Xwms6 Xgwm6a Xgwm6b Xgwm6.2 GWM006 gwm6 gwm6-4B gwm6-5A wms6.2-3 wms6.2-3-5A
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Liu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Remarks	Insert contains repeat (GA)40 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (GA)x40. Product size 205 bp in Cheyenne. In 369 Avena sterilis accessions there were 3 alleles of size 48-60 bp, PIC = negative.
Type	Genomic PCR SSR
PCR primers	5' CGTATCACCTCCTAGCTAAACTAG 3' 5' AGCCTTATCATGACCCTACCTT 3' CGTATCACCTCCTAGCTAAACTAG AGCCTTATCATGACCCTACCTT
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS6
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring