Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Sr35

[Submit comment/correction]

Locus	Sr35
Type	Gene
Chromosome	3A
Chromosome Arm	3AL
Map	Triticum-Genes-3A 40 Wheat-2014-Consensus-Ug99-Update_3A 114
	[ Show Nearby Loci ]
Map Data	Wheat genes Wheat-2014-Consensus-Ug99-Update
2 Point Data	Centromere/Sr35#1 Distance: 34 cM Sr35/R2#1 Distance: 1 cM
Probe	AK335187 [ Show all 9 ]
Associated Gene	Sr35 (Triticum)
Gene Class	Reaction to Puccinia graminis Pers.
Reference	Yu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581. Saintenac C et al. (2013) Identification of Wheat Gene Sr35 That Confers Resistance to Ug99 Stem Rust Race Group Science 341:783-786. Zhang W et al. (2010) Genetic Maps of Stem Rust Resistance Gene Sr35 in Diploid and Hexaploid Wheat Crop Science 50:2464-2474. McIntosh RA et al. (1984) Cytogenetical studies in wheat. XIII. Sr35 - a third gene from Triticum monococcum for resistance to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 92:1-14. Zhang W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr35 MAS Wheat. Marker Assisted Selection in Wheat.
Remark	The location on the 2014 Ug99 Consensus Map is approximate.
Probe for Locus	CFA2076
Locus	[ Hide all but 1 of 6 ] Xcfa2076-3A tin3 cfa2076-3A Sr35 cfa2076 Xcfa2076-5A
Reference	Sourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks	Quality Score = B Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (TG)18 Regularity of motif is imperfect
Type	PCR SSR
PCR primers	Forward 5' CGAAAAACCATGATCGACAG 3' Reverse 5' ACCTGTCCAGCTAGCCTCCA 3'
SSR size	172
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	3D
Source Species	Triticum urartu