Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Sr33

[Submit comment/correction]

Locus	Sr33
Type	Gene Trait
Chromosome	1D
Chromosome Arm	1DS 1S
Map	1DS, Ae. tauschii 30.7 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	1DS, Ae. tauschii Triticeae consensus Wheat genes Wheat, Synthetic x Opata  [ GBrowser ] Wheat-2014-Consensus-Ug99-Update
2 Point Data	Centromere/Sr33#1 Rg2/Sr33#1 Distance: 35 cM Sr33/Gli-D1#1 Distance: 9 cM
Species	Aegilops tauschii Triticum aestivum
Probe	ABC156 BARC152 CFD15
Associated Gene	Sr33 (Aegilops) Sr33 (Triticum)
Gene Class	Reaction to Puccinia graminis Pers.
Reference	Yu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581. [ Show all 6 ]
Data Source	Matthews, David E.
Remark	For map 'Wheat, Synthetic x Opata', position approximated from mapping in another population. Trait marker abc156, whs179a Nearby marker on Composite map: Xabc156b, Xwhs179.1 Position on Composite map estimated by GrainGenes. The location on the 2014 Ug99 Consensus Map is approximate.
Probe for Locus	CFD15
Locus	[ Hide all but 1 of 11 ] Xcfd15-1A Xcfd15-1D Xcfd15 Sr33 cfd15 cfd15(2) Xcfd15-1B cfd15-1A.1 cfd15-1A.2 cfd15-1D cfd15-1A
Reference	Guyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks	Quality Score = B Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (CT)20(TGTA)3 Regularity of motif is perfect
Type	PCR SSR
PCR primers	Forward 5' CTCCCGTATTGAGCAGGAAG 3' Reverse 5' GGCAGGTGTGGTGATGATCT 3'
SSR size	179
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	1A/1D
Source Species	Aegilops tauschii