Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Pm34

[Submit comment/correction]

Locus	Pm34
Type	Trait
Chromosome	5D
Chromosome Arm	5DL
Map	Wheat-Composite2004-5D 94
	[ Show Nearby Loci ]
Species	Triticum aestivum
Probe	BARC144
Associated Gene	Pm34 (Triticum)
Gene Class	Reaction to Erysiphe graminis DC.
Reference	Miranda LM et al. (2006) Pm34: a new powdery mildew resistance gene transferred from Aegilops tauschii Coss. to common wheat (Triticum aestivum L.). Theoretical and Applied Genetics 113:1497.
Remark	Trait marker Xbarc144-5D Nearby marker on Composite map: Xbarc144 Position on Composite map estimated by GrainGenes.
Probe for Locus	BARC144
Locus	[ Hide all but 1 of 8 ] Xbarc144-5D Xbarc144 Xbarc144-5A Pm34 barc144 barc144-5B barc144-6A barc144-5D
General Remarks	Contains motif : (CT)15 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGTTTTAGGTGGACGACATAGATAGA 3' 5' GCGCCACGGGCATTTCTCATAC 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211627
Source Species	Triticum aestivum