Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Ne1

[Submit comment/correction]

Locus	Ne1
Type	Gene Trait
Chromosome	5B
Chromosome Arm	5BS
Map	Triticum-Genes-5B 10.2 Wheat-Composite2004-5B 50
	[ Show Nearby Loci ]
Map Data	Wheat genes
2 Point Data	Centromere/Ne1#1 Distance: 10.5 cM
Species	Triticum aestivum
Probe	BARC74
Associated Gene	Ne1 (Triticum)
Gene Class	Hybrid necrosis
Reference	Chu CG et al. (2006) Molecular mapping of hybrid necrosis genes Ne1 and Ne2 in hexaploid wheat using microsatellite markers. Theoretical and Applied Genetics 112:1374. Nishikawa K et al. (1974) Mapping of progressive necrosis genes Ne1 and Ne2 of common wheat by the telocentric method. Japanese Journal of Breeding 24:277-281.
Remark	Trait marker Xbarc74-5B Nearby marker on Composite map: Xbarc74 Position on Composite map estimated by GrainGenes.
Probe for Locus	BARC74
Locus	[ Hide all but 1 of 6 ] Xbarc74-5B Ne1 Xbarc74 Stb1 barc74-5B barc74
General Remarks	Contains motif : (GA)13(GATA)7(GA)9 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGCTTGCCCCTTCAGGCGAG 3' 5' CGCGGGAGAACCACCAGTGACAGAGC 3'
Amplification Conditions	Annealing temperature = 60
Sequence	BV211851
Source Species	Triticum aestivum