Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG912

[Submit comment/correction]

Locus	MWG912
Type	RFLP
Synonym	Synonym MWG912
Chromosome	1H
Chromosome Arm	1HL
Map	[ Hide all but 1 of 28 ] Barley-Consensus-1H 107.3 Barley-Consensus2-1H 147.9 Barley-ConsensusFHB-1H 147.07 Hordeum-Bins-1H 154 Hordeum-Consensus2005-SNP-1H 145.72 Hordeum-Consensus2006-DArT-1H 144.2 Hordeum-Genes-1H -56.8 Hordeum-Graner2-1H 129.7 Hordeum-HxM-base-1H 125.2 Hordeum-HxT-base-1H 159.9 Hordeum-KxM-1H 169.3 Hordeum-NABGMP1-1H 146.3 Hordeum-NABGMP2-1H 157.4 Hordeum-OPA-2009-1H 199.04 Hordeum-OWB-1H 133.8 Hordeum-OWB-2004-1H 136.2 Hordeum-OWB-2005-1H 132.6 Hordeum-OWB-OPA2008-1H 153.013 Hordeum-OWB-SNP-1H 133.37 Hordeum-Physical-RFLP-1H 158.1 Hordeum-QTLConsensus-Abiotic-1H 145.72 Hordeum-QTLConsensus-Agronomic-1H 145.72 Hordeum-StMo-SNP-1H 153.32 Hordeum-SxM-base-1H 148 Hordeum-SxM-FeedQTL-1H 146.3 Hordeum-SxM-SSAP-1H 141.4 Hv-Consensus2006-Marcel-1H 136.75 Hv-Integrated2009-1H 138.4
	[ Show Nearby Loci ]
QTL with Locus Marker	QHd.HaMo-1H.2 QYld.HaMo-1H.2
Map Data	Barley consensus [ Show all 28 ]
Species	Hordeum vulgare
Probe	MWG912
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG912 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG912-1H [ Show all 10 ]
Probe	MWG912
Locus	MWG912 [ Show all 11 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CACAACCATACAAGCAGGCG 5' TGGCAGATTTGATCGACTCC
STS size	400
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234642 MWG912 MWG912-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare