Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG902

[Submit comment/correction]

Locus	MWG902
Type	RFLP
Synonym	Synonym MWG902
Chromosome	3H
Chromosome Arm	3HL
Map	[ Hide all but 1 of 18 ] Barley-Consensus-3H 72.7 Barley-Consensus2-3H 101.9 Barley-ConsensusFHB-3H 135.69 Hordeum-Bins-3H 156.4 Hordeum-Consensus2005-SNP-3H 133.356 Hordeum-Consensus2006-DArT-3H 141.3 Hordeum-Graner2-3H 126.6 Hordeum-IxF-SSR-3H 103.4 Hordeum-NABGMP1-3H 172.8 Hordeum-Physical-RFLP-3H 166.5 Hordeum-QTLConsensus-Abiotic-3H 133.36 Hordeum-QTLConsensus-Agronomic-3H 133.36 Hordeum-StMo-SNP-3H 133.73 Hordeum-SxM-base-3H 155.4 Hordeum-SxM-FeedQTL-3H 172.8 Hordeum-SxM-SSAP-3H 145.4 Hv-Consensus2006-Marcel-3H 127.65 Hv-Integrated2009-3H 138.8
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_3H_7
Map Data	Barley consensus [ Show all 18 ]
Probe	MWG902
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG902 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	MWG902-3H Xmwg902-3
Probe	MWG902
Locus	Xmwg902-3 MWG902 MWG902-3H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CTGGGAGCATGGTGATCACA 5' CTTGCCGGCCTCATCAAAAA
STS size	300
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234636 AJ234635 MWG902-5 MWG902-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare