Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG858

[Submit comment/correction]

Locus	MWG858
Type	RFLP
Synonym	Synonym Ppd-H1 (Hordeum)
Chromosome	2H
Chromosome Arm	2HS
Map	[ Hide all but 1 of 19 ] Barley-Consensus-2H -29.2 Barley-Consensus2-2H 44 Barley-ConsensusFHB-2H 40.73 Hordeum-Bins-2H 39.9 Hordeum-Consensus2005-SNP-2H 37.312 Hordeum-Consensus2006-DArT-2H 41.8 Hordeum-FxS-FHB-QTL-2H 35.2 Hordeum-Graner2-2H 54.8 Hordeum-IxF-SSR-2H 72 Hordeum-NABGMP1-2H 40.6 Hordeum-QTLConsensus-Abiotic-2H 37.31 Hordeum-QTLConsensus-Agronomic-2H 37.31 Hordeum-StMo-SNP-2H 38 Hordeum-SxM-base-2H 39.3 Hordeum-SxM-FeedQTL-2H 40.6 Hordeum-SxM-SSAP-2H 45.4 Hordeum-SxM-SSR-2H 48.2 Hv-Consensus2006-Marcel-2H 40.43 Hv-Integrated2009-2H 37.8
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.DON_2H_4 MQTL_Du2024.yield-2H.6
Map Data	Barley consensus [ Show all 19 ]
Probe	MWG858
Associated Gene	Ppd-H1 (Hordeum)
Gene Class	Response to photoperiod
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of MWG858 in the Barley, Consensus 2006 DArT maps = 1 The MWG858 RFLP/STS is a gene marker for the Ppd-H1 (Hordeum) gene Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	MWG858-2H [ Show all 7 ]
Gene Associated with Locus	Ppd-H1 (Hordeum)
Gene Class	Response to photoperiod
Allele	Ppd-H1 Igri type (Hordeum) Ppd-H1 Triumph type (Hordeum)
Locus	MWG858 Ppd-H1
Reference	Laurie DA et al. (1994) Genetic analysis of a photoperiod response gene on the short arm of chromosome 2(2H) of Hordeum vulgare (barley). Heredity 72:619-627.
QTL	Ppd-H1 autumn Ppd-H1 spring
Chromosome	2H
Chromosome Arm	2HS
Comment	A photoperiod response gene that affects flowering time under long days (13h or 16h light) but has little effect under short days (10h). In the field it is the major determinant of flowering time variation in the doubled haploid population. Its map location suggests it may be equivalent to the Ppd series of photoperiod response genes in wheat.
Probe	MWG858
Locus	Xmwg858-2 [ Show all 11 ]
Synonym	Synonym HAR35_21728 HAR35_3289
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CGCCTCGTCTGTCATACTCA 5' AAAGAGGATGGCAGCCG
STS size	271
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	AJ234596 AJ234595 MWG858 MWG858-5 MWG858-3
Linkage Group	2H 2
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1 1.4