Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG844a

[Submit comment/correction]

Locus	MWG844a
Type	RFLP SNP
Synonym	Synonym MWG844
Chromosome	2H
Map	Barley-Consensus2-2H 0 [ Show all 12 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 12 ] Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, OPA 2009, Consensus Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP
Species	Hordeum vulgare
Probe	MWG844
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Close, Timothy J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG844 [ Show all 7 ]
Probe for Locus	MWG844
Locus	MWG844a [ Show all 8 ]
Synonym	Synonym HAR35_26589 HAR35_42594 HAR35_9645
Type	Genomic STS
STS primers	5' TCAGGAACCTGGCACCAACG 5' CATCAGCCCGCGATACATCC
STS size	374
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234585 MWG844-5
Polymorphism	MWG844 EcoRI
Insert Enzyme	PstI
Source Species	Hordeum vulgare