Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG844E

[Submit comment/correction]

Locus	MWG844E
Type	RFLP
Synonym	Synonym MWG844
Chromosome	2H
Map	[ Hide all but 1 of 7 ] Hordeum-Consensus2005-SNP-2H 95.765 Hordeum-OWB-2H 104.9 Hordeum-OWB-SNP-2H 110.01 Hordeum-QTLConsensus-Abiotic-2H 95.77 Hordeum-QTLConsensus-Agronomic-2H 95.77 Hv-Consensus2006-Marcel-2H 96.41 Hv-Integrated2009-2H 92.2
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Probe	MWG844
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Possible Orthologs	MWG844 [ Show all 7 ]
Probe for Locus	MWG844
Locus	MWG844a [ Show all 8 ]
Synonym	Synonym HAR35_26589 HAR35_42594 HAR35_9645
Type	Genomic STS
STS primers	5' TCAGGAACCTGGCACCAACG 5' CATCAGCCCGCGATACATCC
STS size	374
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234585 MWG844-5
Polymorphism	MWG844 EcoRI
Insert Enzyme	PstI
Source Species	Hordeum vulgare