Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG835B

[Submit comment/correction]

Locus	MWG835B
Type	RFLP
Synonym	Synonym MWG835
Chromosome	5H
Map	Hordeum-Bins-5H 9.9 Hordeum-Consensus2005-SNP-5H 9.058 Hordeum-QTLConsensus-Abiotic-5H 9.06 Hordeum-QTLConsensus-Agronomic-5H 9.06 Hordeum-StMo-SNP-5H 4.04
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Steptoe x Morex, SNP
Probe	MWG835
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Possible Orthologs	MWG835 [ Show all 6 ]
Probe for Locus	MWG835
Locus	[ Hide all but 1 of 7 ] MWG835 MWG835A Xmwg835-1A.1 Xmwg835-1A.2 Xmwg835-2A Xmwg835-5A MWG835B
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type	Genomic STS
STS primers	5' TTCCCTATTCAAGCCATCAGCAAA 5' GTAACCCATAGATAGCATCTTGTG
STS size	565
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 65 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234580 MWG835-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare