Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG813B

[Submit comment/correction]

Locus	MWG813B
Type	RFLP
Synonym	Synonym MWG813
Chromosome	7H
Map	[ Hide all but 1 of 8 ] Barley-Consensus2-7H 76.2 Hordeum-Bins-7H 77.1 Hordeum-Consensus2005-SNP-7H 87.334 Hordeum-QTLConsensus-Abiotic-7H 87.33 Hordeum-QTLConsensus-Agronomic-7H 87.33 Hordeum-StMo-SNP-7H 73.76 Hv-Consensus2006-Marcel-7H 74.95 Hv-Integrated2009-7H 80.5
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 10 ]
Probe	MWG813
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	MWG813 [ Show all 7 ]
Probe for Locus	MWG813
Locus	MWG813a [ Show all 8 ]
Synonym	Synonym HAR35_15734 HAR35_2555 HAR35_2556
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' TTGGACAGGATGTTGCCA 5' CATTCAGTAACACCGCCATG
STS size	115
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234569 AJ234568 MWG813-5 MWG813-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare