Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG812

[Submit comment/correction]

Locus	MWG812
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	[ Hide all but 1 of 8 ] Barley-Consensus-3H 7.4 Barley-Consensus2-3H 52.1 Hordeum-Bins-3H 79 Hordeum-Giese2-3H 111 Hordeum-Graner2-3H 62.6 Hordeum-Physical-RFLP-3H 95.2 Hv-Consensus2006-Marcel-3H 65.76 Hv-Integrated2009-3H 76.8
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	MWG812
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG812
Locus	MWG812 HI076C19 HD060B9 HD083F15
Type	Genomic STS
STS primers	5' GCGTAGCAGCAAGGCAGCAA 5' CGAGCATACTACTACCAGCG
STS size	495
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234567 MWG812-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare