Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG632a

[Submit comment/correction]

Locus	MWG632a
Type	RFLP
Chromosome	3H
Map	Barley-Consensus2-3H 101.9 Hordeum-Bins-3H 156 Hordeum-Graner2-3H 126.6 Hv-Consensus2006-Marcel-3H 128.99 Hv-Integrated2009-3H 139.2
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	MWG632
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	MWG632 [ Show all 7 ]
Probe for Locus	MWG632
Locus	MWG632b [ Show all 8 ]
Synonym	Synonym HAR35_730
Type	Genomic STS
STS primers	5' CAACAGCAGCACAAGGTCGCTGCCT 5' GGTGGAAGCCAAGTCTGACATCGTC
STS size	473
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234546 MWG632-5
Polymorphism	[ Hide all but 1 of 6 ] MWG632 EcoRI MWG632 EcoRV MWG632 BamHI MWG632 DraI MWG632 HindIII MWG632 XbaI
Insert Enzyme	PstI
Source Species	Hordeum vulgare