Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG522

[Submit comment/correction]

Locus	MWG522
Type	RFLP
Synonym	Synonym MWG522
Chromosome	5H
Chromosome Arm	5HL
Map	Barley-Consensus-5H 36.7 [ Show all 17 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHt.HaTR-5H.2
Map Data	Barley consensus [ Show all 19 ]
Species	Hordeum vulgare
Probe	MWG522
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG522-5H Xmwg522 Xmwg522-5A mwg522 mwg522-5A
Probe	MWG522
Locus	[ Hide all but 1 of 6 ] MWG522 Xmwg522-5A Xmwg522 MWG522-5H mwg522 mwg522-5A
Synonym	Synonym HAR35_29448
Type	Genomic STS
STS primers	5' CTCACCTGTCTGTATGCACGCATGC 5' CACAAGGATCAGCAACTGTGT
STS size	ca. 1170
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	AJ234483 AJ234482 MWG522 MWG522-5 MWG522-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare