Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2018

[Submit comment/correction]

Locus	MWG2018
Type	RFLP
Synonym	Synonym MWG2018
Chromosome	7H
Chromosome Arm	7HS
Map	[ Hide all but 1 of 10 ] Barley-Consensus-7H -77.5 Barley-Consensus2-7H 0 Hordeum-Bins-7H 3.4 Hordeum-Consensus2005-SNP-7H 19.008 Hordeum-Graner2-7H 4.3 Hordeum-QTLConsensus-Abiotic-7H 19.01 Hordeum-QTLConsensus-Agronomic-7H 19.01 Hordeum-StMo-SNP-7H 4.51 Hv-Consensus2006-Marcel-7H 7.72 Hv-Integrated2009-7H 9.6
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 10 ]
Probe	MWG2018
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg2018
Probe	MWG2018
Locus	MWG2018 Xmwg2018
Type	Genomic STS
STS primers	5' TCGACGGCAAGCTCCTGACC 5' GCGACGGCAGTATGGTGAAGC
STS size	342
Amplification Conditions	STS annealing temperature 62-65 oC
Sequence	AJ234706 MWG2018-5
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare