Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: IWA3805

[Submit comment/correction]

Locus	IWA3805
Type	SNP
Synonym	Other name BS00182599 wsnp_Ex_c41953_48658353 Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm	1A
Map	Durum Wheat, NSGC Lr 1A 103.2 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	Qfhb.nc-1A
Map Data	[ Hide all but 1 of 11 ] Durum Wheat, NSGC Lr Wheat, 2013 9K Consensus Wheat, Finch x Eltan Wheat, Yr genes and QTL Wheat, Yr Update, 2021 Wheat_2014_90KSNP Wheat_AB, Ben x PI41025 Wheat_AB, Mohawk x Cocorit69 Wheat_AB, Simeto x Levante Wheat_AB, Simeto x Molise Colli Wheat_AB_2015_Consensus
Species	Triticum aestivum
Probe	IWA3805_KASP wsnp_Ex_c41953_48658353
Reference	Petersen S et al. (2016) Mapping of Fusarium Head Blight Resistance Quantitative Trait Loci in Winter Wheat Cultivar NC-Neuse Crop Science 56:1473-1483. Wang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796. Cavanagh CR et al. (2013) Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars Proceedings of the National Academy of Sciences, USA 110:8057-8062.
Possible Orthologs	iwa3805-1A
Probe for Locus	IWA3805_KASP
Locus	wsnp_Ex_c41953_48658353 IWA3805
Reference	Petersen S et al. (2016) Mapping of Fusarium Head Blight Resistance Quantitative Trait Loci in Winter Wheat Cultivar NC-Neuse Crop Science 56:1473-1483.
Type	KASP
PCR primers	FAM 5' AACTTTGCTGTCAACTTTGAGGA VIC 5' CTAACTTTGCTGTCAACTTTGAGGG Common 5' TTACTGCAACTGATGGGTGCACTTTATAT