Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HvLTPPB

[Submit comment/correction]

Locus	HvLTPPB
Type	Microsatellite
Synonym	Synonym HvLTPPB HvLTPPB.2
Chromosome	3 (3H) 3H
Map	Barley, B73xCPI-3H 18.3 [ Show all 15 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 15 ]
Species	Hordeum spontaneum Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HvLTPPB HvLTPPB.2
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 8 ] Assigned to a barley chromosome by PCR screening of wheat barley addition lines Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : L94 x Vada, OWBrecessive x OWBdominant, Lina x H. spontaneum Insert contains repeat (AC)10(AT)5 Polymorphic Information Content (PIC) = 0.61 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	HvLTPPB.2
Locus	HvLTPPB
Reference	Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
General Remarks	Insert contains repeat (ac)10
Type	SSR
PCR primers	Left 5' TGCTGAGACGCTGAGTACGTTG Right 5' CAAACTCACGATTCCTCTCAAAG
SSR size	216
Amplification Conditions	Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	Z37115
Source Species	Hordeum vulgare