Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HVCMA

[Submit comment/correction]

Locus	HVCMA
Type	Gene Microsatellite
Synonym	Synonym HVCMA POPA1_0721
Chromosome	1 (7H) 7H
Map	Barley-consensus-2003-7H 74 [ Show all 17 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 17 ] Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxHs/QTL Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, HN x H602, Sato2009 Barley, Integrated, Marcel 2009 Barley, Lina x H.spont, SNP Barley, Lx41 Barley, LxHs Barley, OWB Barley, OWB, SNP Barley, TxE Barley, Vada x SusPtrit
Species	Hordeum spontaneum Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	HVCMA HVCMA-187
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Becker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Data Source	Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Probe for Locus	HVCMA-187
Locus	HVCMA
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Becker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Type	SSR
PCR primers	GCCTCGGTTTGGACATATAAAG GTAAAGCAAATGTTGAGCAACG