Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: HD054L6

[Submit comment/correction]

Locus	HD054L6
Probe	MWG920
Probe for Locus	MWG920
Locus	[ Hide all but 1 of 20 ] MWG920 HD020D12 RI003F19 HI095K12 HI095K13 HD015M18 HD054L6 Xmwg920 MWG920-1A MWG920-1B MWG920A Xmwg920-1A.1 Xmwg920-1A.2 Xmwg920-2A Xmwg920-5A MWG920.1B MWG920.1A Xmwg920.1 MWG920.1a-5H Xmwg920.2
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTCACCGCCCGTCACGTTGCGCTTCA 5' GAGTACCGCGACCGTCGCGCTCGAGC
STS size	183
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234647 MWG920-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare