Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Glu-D1

[Submit comment/correction]

Gene	Glu-D1
Synonym	Synonym Glu-D1 (Triticum)
Gene Product	high-molecular-weight glutenin subunit 2.6
Sequence	AB359016 AB359016_1.cds
Locus	Glu-D1
Type	Gene
Synonym	Other name Glu-1D
Chromosome	1D
Chromosome Arm	1DL
Map	Ta-Synthetic/Opata-1D 74 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] T.tauschii Wheat genes Wheat, Composite, 2004 Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, SSR 2 Wheat, Yr genes and QTL Wheat, Yr Update, 2021
2 Point Data	Centromere/Glu-D1#1 Distance: 10.2 cM [ Show all 11 ]
Probe	GLU D1d Ishikawa G and Nakamura T (2007) A new co-dominant PCR-based marker to identify the high-molecular-weight glutenin subunit combination (5+10) of common wheat. Wheat Information Service 103:1-3. GLU Dx5-2 GLU Dy-10/12 Smith R et al. (1994) Identification of glutenin alleles in wheat and triticale using PCR generated DNA markers Crop Science 34:1373-1378. UMN25 Liu S et al. (2008) New DNA markers for high molecular weight glutenin subunits in wheat. Theoretical and Applied Genetics 118:177-183. UMN26 Liu S et al. (2008) New DNA markers for high molecular weight glutenin subunits in wheat. Theoretical and Applied Genetics 118:177-183.
Associated Gene	Glu-D1 (Triticum)
Gene Class	Glutenins
Reference	Singh NK and Shepherd KW (1988) Linkage mapping of genes controlling endosperm storage proteins in wheat. 2. Genes on the long arm of the group 1 chromosomes. Theoretical and Applied Genetics 75:642-650. Payne PI et al. (1982) Structural and genetical studies on the high-molecular-weight subunits of wheat glutenin III. Telocentric mapping of the subunit genes on the long arms of the homoeologous group 1 chromosomes. Theoretical and Applied Genetics 63:129-138. MAS Wheat. Functional Markers for processing quality genes in wheat MAS Wheat. Marker Assisted Selection in Wheat.
Remark	Ordered at LOD < 3.0 in map 'Wheat, Synthetic x Opata'.
Possible Orthologs	Glu-1 [ Show all 17 ]
Probe for Locus	UMN25
Locus	Glu-D1 umn25
Reference	Liu S et al. (2008) New DNA markers for high molecular weight glutenin subunits in wheat. Theoretical and Applied Genetics 118:177-183. MAS Wheat. Functional Markers for processing quality genes in wheat MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers	5' UMN25F: GGGACAATACGAGCAGCAAA 3' 5' UMN25R: CTTGTTCCGGTTGTTGCCA 3'
Specificity	Specific for High molecular weight (HMW) glutenin Glu-D1 subunits Dx2 and Dx5. PCR primers produced a 299 bp fragment in the presence of the Dx2 subunit and a 281 bp fragment in the presence of the Dx5 subunit
Source Species	Avena sativa