Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: GMS001

[Submit comment/correction]

Locus	GMS001
Type	Microsatellite
Synonym	Synonym GMS1
Chromosome	5H
Map	Barley-ConsensusFHB-5H 194.51 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 10 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	GMS1
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remark	[ Hide all but 1 of 8 ] Assigned to a barley chromosome by PCR screening of wheat barley addition lines Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : L94 x Vada, Steptoe x Morex, Lina x H. spontaneum Insert contains repeat (CT)7n(CT)2 Polymorphic Information Content (PIC) = 0.69 Developing laboratory = IPK (D. Struss)
Probe for Locus	GMS1
Locus	GMS0001 GMS001 GMS1
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Waugh R and Marshall DF (2005) Barley SSRs from the Scottish Crop Research Institute. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks	SSR motif: (CT)7TTT(CT)2
Type	SSR
PCR primers	CTGACCCTTTGCTTAACATGC TCAGCGTGACAAACAATAAAGG
SSR size	134
Amplification Conditions	35-45 cycles: 1 min @ 94C, 1 min @ 60C, 2 min @ 72C; 1 cycle: 60 mins @ 72C.