Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Ebmac0679

[Submit comment/correction]

Locus	Ebmac0679
Type	Microsatellite
Synonym	Synonym EBmac679
Chromosome	4H
Map	[ Hide all but 1 of 9 ] Barley, B73xCPI-4H 101 Hordeum-Consensus2005-SNP-4H 91.719 Hordeum-Consensus2007-SSR-4H 94.5 Hordeum-LiHs-SNP-4H 84.38 Hordeum-LxHs-4H 83 Hordeum-QTLConsensus-Abiotic-4H 91.72 Hordeum-QTLConsensus-Agronomic-4H 91.72 Hv-Consensus2006-Marcel-4H 94.5 Hv-Integrated2009-4H 104.9
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Ebmac0679 EBmac679
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 7 ]
Probe for Locus	EBmac679
Locus	Ebmac0679 EBmac679
Synonym	Other name Ebmac0679 EBmac0679
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)22 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.8
Type	PCR SSR
PCR primers	5' ATTGGAGCGGATTAGGAT 3' 5' CCCTATGTCATGTAGGAGATG 3' ATTGGAGCGGATTAGGAT CCCTATGTCATGTAGGAGATG
SSR size	148
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare