Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac0708

[Submit comment/correction]

Locus	EBmac0708
Type	Microsatellite
Synonym	Synonym EBmac708
Chromosome	3H
Map	[ Hide all but 1 of 8 ] Barley, B73xCPI-3H 126.6 Barley-ConsensusFHB-3H 151.69 Hordeum-Consensus2005-SNP-3H 156.61 Hordeum-Consensus2007-SSR-3H 142.33 Hordeum-LiHs-SNP-3H 148.51 Hordeum-LxHs-3H 156 Hordeum-QTLConsensus-Abiotic-3H 156.61 Hordeum-QTLConsensus-Agronomic-3H 156.61
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	EBmac0708 EBmac708
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AT)5(GT)16CT (GT)5(GC)6 Polymorphic Information Content (PIC) = 0.79 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	EBmac708
Probe for Locus	EBmac708
Locus	EBmac0708 EBmac708
Synonym	Other name EBmac0708
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AT)5(GT)16CT(GT)5(GC)6 Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products Diversity Index (DI) = 0.79
Type	PCR SSR
PCR primers	5' AATTTTTGTTTCCCATGC 3' 5' AGCCCTATTGTCACAGTTTT 3'
SSR size	138
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare