Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: EBmac0615

[Submit comment/correction]

Locus	EBmac0615
Type	Microsatellite
Synonym	Synonym EBmac615
Chromosome	2H
Map	[ Hide all but 1 of 9 ] Barley, B73xCPI-2H 71.7 Barley-ConsensusFHB-2H 72.97 Hordeum-Consensus2005-SNP-2H 74.686 Hordeum-Consensus2007-SSR-2H 65.09 Hordeum-FxS-FHB-QTL-2H 81.9 Hordeum-LiHs-SNP-2H 70.53 Hordeum-LxHs-2H 56 Hordeum-QTLConsensus-Abiotic-2H 74.69 Hordeum-QTLConsensus-Agronomic-2H 74.69
	[ Show Nearby Loci ]
QTL with Locus Marker	QFhs.umn-2H.2 QHD.umn-2H.1
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	EBmac0615 EBmac615
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (TG)5CG(TG)3, (TG)10 Polymorphic Information Content (PIC) = 0.23 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	EBmac615
Probe for Locus	EBmac615
Locus	EBmac0615 EBmac615
Synonym	Other name EBmac0615
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (TG)5CG(TG)3,(TG)10 Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products Diversity Index (DI) = 0.23
Type	PCR SSR
PCR primers	5' AATTGGTTCGAGTCATAGCT 3' 5' CTAGTGGGTGTATGCAAGTG 3'
SSR size	173
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare