Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Cab2

[Submit comment/correction]

Locus	Cab2
Type	RFLP
Synonym	Synonym CAB-2 pKG1490
Chromosome	1H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 103.1 [ Show all 15 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 15 ] Barley consensus Barley consensus 2 Barley genes Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Probe	CAB-2 pKG1490
Reference	Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	XCab2
Probe for Locus	CAB-2
Locus	Cab2
Synonym	Other name pKG1490
Type	STS
PCR primers	CATAAGCTGAATTCCAACACCG ACTAGTCGACGAAGTTGGTGGCGAAGGC
Source Species	Hordeum vulgare