Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: CDO749

[Submit comment/correction]

Locus	CDO749
Type	RFLP
Synonym	Synonym CDO749
Chromosome	2B 5H
Chromosome Arm	5HS
Map	Barley-consensus-2003-5H 22.7 [ Show all 18 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QPm.PrNu-5H
Map Data	[ Hide all but 1 of 19 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, CxS Barley, GxH Barley, Integrated, Marcel 2009 Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs Wheat chromosome arm map
Probe	CDO749
Homology	NARB_SYNP7 e-value: 5.1 NITRATE REDUCTASE (strain PCC 7942) AC006550_8 e-value: 2e-55 (AC006550) Identical to gb precursor protein from Arabidopsis thaliana. ESTs gb|H35836, gb|AA651295 and gb|AA721862 come from this gene.
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Number of populations contributing to the placement of CDO749 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	CDO749B [ Show all 12 ]
Probe	CDO749
Locus	CDO749 [ Show all 13 ]
Synonym	Synonym HAR35_26576 HAR35_35245 HAR35_7834
External Databases	DDBJ EMBL GenBank
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
Remarks	Uni-ZAP XR library OatUni-ZAPXR [c] OatUni-ZAPXR
Type	cDNA STS
PCR primers	TCTCAGGAGCAGGTCAGTTA GCGGAGTAGTATTAGTCACA
Sequence	BE439150 [ Show all 7 ]
Polymorphism	CDO749 EcoRI
Linkage Group	5S,2L[b7SH] 2L,5S [b 7S]
Insert Enzyme	EcoRI XhoI
Source Species	Avena sativa
Source Germplasm	Brooks (oat)
Source Tissue	etiolated leaf
Insert Size	1.8
PCR size	1.8