Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: CDO474C

[Submit comment/correction]

Locus	CDO474C
Type	RFLP
Chromosome	2H
Map	Barley-Consensus2-2H 79.2 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley consensus 2 Barley genes Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, KxM Barley, SxM Barley, SxM, Feed QTLs
Probe	CDO474
Data Source	Blake, Tom 05.04.19 Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	CDO474 [ Show all 7 ]
Probe for Locus	CDO474
Locus	CDO474C [ Show all 8 ]
External Databases	DDBJ EMBL GenBank
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks	Uni-ZAP XR library OatUni-ZAPXR [c]
Type	cDNA STS
PCR primers	TTTGGACCGTTCAGAGTTGC ACGTCCTCTCCAAGGCCAAT
Sequence	CDO474
Linkage Group	[b 4L] 2
Insert Enzyme	EcoRI XhoI
Source Species	Avena sativa
Source Germplasm	Brooks (oat)
Source Tissue	etiolated leaf
Insert Size	1.6
PCR size	1.6