Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0206

[Submit comment/correction]

Locus	Bmag0206
Type	Microsatellite
Synonym	Synonym Bmag206
Chromosome	7H
Map	Barley, B73xCPI-7H 17.9 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 10 ]
Species	Hordeum vulgare
Probe	Bmag0206 Bmag206
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Igri x Franka, Lina x H. spontaneum Insert contains repeat (GT)5(AG)14 Polymorphic Information Content (PIC) = 0.79 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmag206
Probe for Locus	Bmag206
Locus	Bmag0206 Bmag206
Synonym	Other name Bmag0206
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (GT)5(AG)14 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.79
Type	PCR SSR
PCR primers	5' TTTTCCCCTATTATAGTGACG 3' 5' TAGAACTGGGTATTTCCTTGA 3' TTTTCCCCTATTATAGTGACG TAGAACTGGGTATTTCCTTGA
SSR size	239
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare