Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0218c

[Submit comment/correction]

Locus	Bmac0218c
Type	Microsatellite
Synonym	Synonym Bmac218
Chromosome	6H
Map	Barley-ConsensusFHB-6H 65.9 [ Show all 12 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 12 ]
Species	Hordeum vulgare
Probe	Bmac0218 Bmac218
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant Insert contains repeat (AC)14 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac0218 Bmac218 Bmac0218a Bmac218a-2H
Probe for Locus	Bmac0218
Locus	Bmac0218a Bmac0218c
Synonym	Other name Bmac218
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	ATTGCATTGATTAACTCCTACA GGGGGAATCTTTGTGTAAG