Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0187

[Submit comment/correction]

Locus	Bmac0187
Type	Microsatellite
Synonym	Synonym Bmac187
Chromosome	7H
Map	Barley, B73xCPI-7H 85.7 [ Show all 13 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 13 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0187 Bmac187
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Steptoe x Morex, OWBrecessive x OWBdominant, Lina x H. spontaneum Insert contains repeat (AC)13(AT)9 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac187 Bmac187-7H
Probe for Locus	Bmac187
Locus	Bmac0187 Bmac187-7H Bmac187
Synonym	Other name Bmac0187
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)13(AT)9 Quality = 2: Single product, relatively strong stutter bands
Type	PCR SSR
PCR primers	5' GCTCTCTCTCAGAAAAATGAA 3' 5' GAATTATTCTAGGGCTGTGAA 3' GCTCTCTCTCAGAAAAATGAA GAATTATTCTAGGGCTGTGAA
SSR size	177
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare