Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0047d

[Submit comment/correction]

Locus	Bmac0047d
Type	Microsatellite
Chromosome	7H
Map	Barley-ConsensusFHB-7H 77.8 Hordeum-Consensus2007-SSR-7H 81.8 Hv-Consensus2006-Marcel-7H 81.8
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB
Species	Hordeum vulgare
Probe	Bmac0047 Bmac47
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant Insert contains repeat (AC)16 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac0047 [ Show all 8 ]
Probe for Locus	Bmac0047
Locus	[ Hide all but 1 of 6 ] Bmac0047 Bmac0047b Bmac0047a Bmac0047c Bmac0047e Bmac0047d
Synonym	Other name Bmac47
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	AACACACGTACACAAATACACA ACGTCCATCACTTTGACC