Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0047

[Submit comment/correction]

Locus	Bmac0047
Type	Microsatellite
Map	Barley, B73xCPI-4H 56.3
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI
Probe	Bmac0047
Possible Orthologs	[ Hide all but 1 of 8 ] Bmac47 Bmac0047a Bmac0047b Bmac047B Bmac047b-7H Bmac0047c Bmac0047d Bmac0047e
Probe	Bmac0047
Locus	Bmac0047 [ Show all 6 ]
Synonym	Other name Bmac47
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	AACACACGTACACAAATACACA ACGTCCATCACTTTGACC