Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG705B

[Submit comment/correction]

Locus	ABG705B
Type	RFLP
Map	Barley-Consensus2-6H 66.2 Hordeum-Bins-6H 66 Hordeum-NABGMP2-6H 75.3
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley, BinMap 2005 Barley, HxT
Probe	ABG705
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	ABG705 [ Show all 8 ]
Probe for Locus	ABG705
Locus	[ Hide all but 1 of 11 ] ABG705 Xabg705-5B Xabg705 RI030A24 D1.1_ctg5713 ABG705A ABG705B Xabg705-5A ABG705-5H abg705 abg705-5B
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CTAGAGTGCCTAGAAGATTG TTACTTAGAAAACCGATGAA
Sequence	L44087 ABG705
Source Species	Hordeum vulgare