Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG55

[Submit comment/correction]

Locus	ABG55
Type	RFLP STS
Synonym	Synonym ABG055
Chromosome	1H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 109.1 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Probe	ABG55
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	ABG055 [ Show all 8 ]
Probe	ABG55
Locus	[ Hide all but 1 of 18 ] ABG055 ABG55 RI037F3 RI025O20 RI033N17 RI035H4 RI042C7 RI050J23 HD013B20 HD019C23 HD022O15 Xabg55 Xabg55-1A.1 Xabg55-1A.2 Xabg55-3A Xabg55-4A Xabg55-5A ABG055-1H
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	ATCCGCAGCAGATCGAGGAC CAGGCAAGATTGACGCAGTA
Sequence	L44040 ABG55
Source Species	Hordeum vulgare