Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG497b

[Submit comment/correction]

Locus	ABG497b
Type	RFLP
Chromosome	7H
Map	[ Hide all but 1 of 8 ] Barley-consensus-2003-7H 140.6 Barley-Consensus2-7H 31.7 Barley-ConsensusFHB-7H 117.7 Hordeum-Bins-7H 34 Hordeum-FxS-FHB-QTL-7H 171.9 Hordeum-Graner2-7H 54.5 Hv-Consensus2006-Marcel-7H 35.39 Hv-Integrated2009-7H 36.3
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 8 ]
Probe	ABG497
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	ABG497 ABG497(A) ABG497(B) ABG497A Xabg497
Probe for Locus	ABG497
Locus	ABG497 [ Show all 6 ]
Synonym	Synonym HAR35_11854
Type	Genomic STS
STS primers	5' GGATGAGGAGATACATGGAGC 5' CATTTGGTGGTCAACAAGGC
STS size	ca. 500
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BH854365 BH854364 ABG497-5 ABG497-3
Source Species	Hordeum vulgare