Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG394

[Submit comment/correction]

Locus	ABG394
Type	RFLP
Synonym	Synonym ABG394
Chromosome	4H
Chromosome Arm	4HL
Map	[ Hide all but 1 of 11 ] Barley-Consensus-4H 48.8 Barley-Consensus2-4H 75 Hordeum-Bins-4H 100.9 Hordeum-Consensus2005-SNP-4H 97.726 Hordeum-NABGMP1-4H 127.3 Hordeum-QTLConsensus-Abiotic-4H 97.73 Hordeum-QTLConsensus-Agronomic-4H 97.73 Hordeum-StMo-SNP-4H 98.01 Hordeum-SxM-FeedQTL-4H 127.3 Hv-Consensus2006-Marcel-4H 100.98 Hv-Integrated2009-4H 111.9
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 11 ]
Probe	ABG394
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Xabg394
Probe	ABG394
Locus	ABG394 Xabg394
Synonym	Synonym HAR35_26146
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CGATGTAATAAAAATTAGGT GGGTGTTGCTCATGCTCTTT
Sequence	L43990 ABG394
Source Species	Hordeum vulgare