Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG387b

[Submit comment/correction]

Locus	ABG387b
Type	RFLP
Synonym	Synonym ABG387
Chromosome	6H
Map	Barley-Consensus2-6H 43.5 [ Show all 21 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QNb.StMo-6H.1 QSsg.StMo-6H
Map Data	Barley consensus 2 [ Show all 21 ]
Species	Hordeum vulgare
Probe	ABG387
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of ABG387B in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	[ Hide all but 1 of 14 ] ABG387 ABG387a ABG387a-1H ABG387b-6H ABG387C Xabg387 Xabg387-1 Xabg387-1A.1 Xabg387-1A.2 Xabg387-3A Xabg387-4A Xabg387-5A Xabg387-6A Xabg387-6B
Probe for Locus	ABG387
Locus	ABG387a [ Show all 15 ]
Synonym	Synonym HAR35_1739
Type	Genomic STS
STS primers	5' GCACTGGCATAGTCTCACAA 5' CGATGCTGGTTCGGTCATAC
STS size	198
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	BH854352 ABG387-5
Source Species	Hordeum vulgare