Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG1

[Submit comment/correction]

Locus	ABG1
Type	RFLP
Synonym	Synonym ABG001A
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-Consensus-6H 9.5 Hordeum-DxM-6H 63.1 Hordeum-DxM-Dnh-6H 63.1 Hordeum-Graner2-6H 73.4 Hv-Consensus2006-Marcel-6H 75.38
	[ Show Nearby Loci ]
Map Data	Barley consensus Barley, Consensus 2006, Marcel Barley, Dicktoo x Morex Barley, DxM, Dhn genes Barley, IxF
Species	Hordeum vulgare
Probe	ABG1
Reference	Choi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	[ Hide all but 1 of 8 ] ABG001 ABG001A ABG1A ABG001B ABG1B ABG001C ABG1C ABG001G
Probe	ABG1
Locus	ABG1 [ Show all 13 ]
Synonym	Synonym HAR35_22556
Type	Genomic STS
STS primers	5' CGTTGTTGATTCAGCTGGTT 5' GGCTTGCACATACTATTACA
STS size	378
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	BH854348 ABG1-5
Source Species	Hordeum vulgare