Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC303

[Submit comment/correction]

Locus	ABC303
Type	RFLP
Synonym	Synonym ABC303
Chromosome	4H
Chromosome Arm	4HS
Map	Barley-Consensus-4H -7 [ Show all 21 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_4H_4
Map Data	[ Hide all but 1 of 21 ] Barley consensus Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, KxM Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP Barley, Steptoe x Morex, SNP Barley, SxM Barley, SxM, Feed QTLs Barley, Zhedar2, FHB QTL
Species	Hordeum vulgare
Probe	ABC303
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC303 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABC303-4H Xabc303-2B Xabc303-6B
Probe	ABC303
Locus	ABC303 Xabc303-2B Xabc303-6B ABC303-4H
External Databases	DDBJ EMBL GenBank
Type	cDNA STS
PCR primers	CTTTACAGCGACGAGACCAG GAGGCTGTTATTATCTTACC
Sequence	L43944 ABC303
Source Species	Hordeum vulgare