Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC165C

[Submit comment/correction]

Locus	ABC165C
Type	RFLP
Chromosome	1H
Map	Hordeum-Bins-1H 1 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley, BinMap 2005 Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009 Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008
Species	Hordeum vulgare
Probe	ABC165
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of ABC165C in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Possible Orthologs	ABC165 ABC165-2H ABC165A ABC165D
Probe for Locus	ABC165
Locus	ABC165 ABC165C ABC165D ABC165A ABC165-2H
External Databases	DDBJ EMBL GenBank
General Remarks	Steptoe malt cDNA
Type	cDNA STS
PCR primers	CAATGACTTCAAGGGGTCTG TCCATACCATTCCCATCTAA
Sequence	L43932
Linkage Group	Group 2 2
Source Species	Hordeum vulgare
Source Germplasm	Steptoe (barley)
Source Tissue	malt
Insert Size	0.5