Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC160

[Submit comment/correction]

Locus	ABC160
Type	RFLP STS
Synonym	Synonym ABC160
Chromosome	1H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 39.2 [ Show all 23 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QBgn.StMo-1H [ Show all 6 ]
Map Data	[ Hide all but 1 of 23 ] Barley consensus Barley consensus 2 Barley genes Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, AxK Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, OWB Barley, OWB, 2004 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	ABC160
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC160 in the Barley, Consensus 2006 DArT maps = 2 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec
Possible Orthologs	ABC160-1H [ Show all 6 ]
Probe	ABC160
Locus	ABC160 [ Show all 11 ]
Synonym	Synonym HAR35_23388
External Databases	DDBJ EMBL GenBank
Remarks	Steptoe malt cDNA
Type	cDNA STS
PCR primers	GCCAGCGCTCCGGTCTGGTC AACAAGGCCGCATGGATGTA
Sequence	L43929 ABC160 ABC160-5
Linkage Group	Group 5
Source Species	Hordeum vulgare
Insert Size	0.3