Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC156d

[Submit comment/correction]

Locus	ABC156d
Type	RFLP
Synonym	Synonym ABC156
Chromosome	7H
Map	Barley-Consensus2-7H 59.6 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QBgnm.StMo-7H.1 QBgsk.StMo-7H.1
Map Data	Barley consensus 2 [ Show all 16 ]
Probe	ABC156
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of ABC156D in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	ABC156 [ Show all 23 ]
Probe for Locus	ABC156
Locus	[ Hide all but 1 of 25 ] Sr33 Xabc156-1 ABC156 Xabc156-1A Xabc156-1D Xabc156-1B ABC156d ABC156A ABC156C Xabc156 ABC156B Xabc156c Xabc156.3 Xabc156a Xabc156b ABC156(B) ABC156(E) ABC156(C) ABC156(D) abc156 ABC156(A) ABC156Aa abc156-1A abc156-1B abc156-1D
Synonym	Synonym HAR35_37808
General Remarks	Steptoe malt cDNA
Type	cDNA STS
STS primers	5' TTACGGGATCAAAGCTGAGGC 5' GACAAGCAACACCAACCAAGC
STS size	197
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	BQ548054 ABC156 ABC156-5
Polymorphism	ABC156 XbaI ABC156 EcoRI ABC156 EcoRV ABC156 HindIII ABC156 DraI
Linkage Group	Groups 2,3,1 2 3
Source Species	Hordeum vulgare
Source Germplasm	Steptoe (barley)
Source Tissue	malt
Insert Size	0.3